PRINCIPLE OF ELISA ......(HOW TO)....

Colleague from department medicine from Michigan has revealed about ELISA Technique in their chapter. The Following is their note :

1. Introduction
ELISA is the abbreviation of enzyme-linked immunosorbent assay. It is a useful and powerful method in estimating ng/ml to pg/ml ordered materials in the solution, such as serum, urine, sperm and culture supernatant (Savige, 1998). ELISA has been widely used in the life science researches (Ma, 1994; 2004).
The basic principle of an ELISA is to use an enzyme to detect the binding of antigen (Ag) antibody (Ab). The enzyme converts a colorless substrate (chromogen) to a colored product, indicating the presence of Ag:Ab binding. An ELISA can be used to detect either the presence of Ags or Abs in a sample, depending on how the test is designed.

2. Materials and Methods
Homogenize tissue with 5 times of protein extract buffer  centrifuge 10,000 rpm 20 minutes  0.1 ml supernatant each well  over night at 4oC  PBS with 0.5% BSA washing 3 X 3 minutes  0.1 ml diluted primary antibody 1-2 hour at room temperature  PBS washing 3 X 3 minutes  0.1 ml diluted secondary antibody 1-2 hour at room temperature  PBS washing 3 X 3 minutes  dye (0.2 ml pNPP)  0.05 ml 3 N NaOH  O.D. (405 nm) measurement.

2.1 Extract buffer:
50 mM Tris-HCl or 50 mM HEPES (pH 7.4)
150 mM NaCl
0.02% sodium azide
0.1% SDS
0.1 mg/ml phenylmethylsulfonyl fluoride (PMSF)
0.001 mg/ml aprotinin
1% Nonidet P-40 (NP-40) or 1% Triton X-100
(The half-life of a 0.02 mM aqueous solution of PMSF is about 35 minutes. PMSF is usually stored as a 10 mM or 100 mM stack solution 1.74 or 17.4 mg/ml in isopropanol at –20oC).
2.2 Homogenize sample under ice.
2.3 Centrifuge sample at 10,000 rpm for 20 minutes at 4oC.
2.4 Keep supernatant at -70oC until usage.
2.5 PBS: Phosphate-buffered saline (PBS), pH 7.4, 1000 ml (NaCl 8 g, KCl 0.2 g, Na2HPO4 1.44 g, KH2PO4 0.24 g, adjust to pH 7.4 with HCl). Add 0.5% BSA of 1% milk into PBS when washing processed. It can also use Dulbecco's PBS or try others. Instead of BSA, it can use gelatin or milk. Skim (0.5% to 1%) milk could reduce the non-specific reaction.
2.6 Antibody: Primary and secondary antibodies are normally 1:1000 to 1:2000 diluted by PBS and 0.1 ml each well.
2.7 Dye: Use alkaline phosphatase yellow (pNPP) liquid substrate as the dye for the ELISA (Derango et al. 1996). This product is supplied as a ready-to-use buffered alkaline phosphatase substrate p-nitro-phenylphosphate (pNPP). Prior to reaction with alkaline phosphatase, the substrate should appear as a colorless to pale yellow solution. It will develop a yellow reaction product when reacted with phosphatase in microwell applications. For the end-point assays, the reaction can be stopped with 0.05 ml/well of 3 N NaOH for every 0.2 ml of substrate reaction. Following the reaction with alkaline phosphatase, a yellow reaction product forms can be read at 405 nm.

3. More Information
3.1 Using Polyclonal Antibodies:
(1) Antibody purification: Protein G column is the best for this purpose.
(2) Conjugate: Making conjugate is the most important part (e.g. horseradish peroxidase).
(3) 96-well plate: Making the solid phase using the 96-well plate.
3.2 Buffers and other reagents:
(1) Plate buffer: 0.1 M Sodium carbonate buffer, pH 9.5.
(2) Reaction buffer: 0.01 M Sodium phosphate buffer, pH 7.2, 0.15 M NaCl (PBS), 0.5% BSA, 0.05% thimerosal; You can also use Dulbecco's PBS or try others. Instead of BSA, you can use gelatin. Skim (0.5% to 1%) milk could reduce the non-specific reaction.
(3) Washing buffer: 0.05% Tween-20, 0.01 M Sodium phosphate buffer, pH 7.2 or 0.05% Tween-20, 0.15 M NaCl.
(4) Developing buffer: 0.05 M Sodium acetate buffer, pH 5.5.
(5) TMB stock solution: Tetramethylbenzidine 1 mg/ml in DMSO.
3.3 Making Conjugate:
(1) Nakane's method.
(2) Glutaraldehyde method.
(3) Maleimide method.
3.4 Steps:
(1) 2 mg Horseradish peroxidase (HRP) in 1 ml water: A.
(2) 21.4 mg NaIO4 (never to be NaIO3) in 1 ml water: B.
(3) 100 micro-l of B into A: Color will change to the dark green!
(4) Wait for 10 min at room temperature.
(5) Put into the dialysis tube (such as Molecular cut off 20,000).
(6) F. Put the tube into 5 mM NaAcetate buffer, pH 4.0 in a 2 to 3 l flask.
(7) Dialysis overnight: Color will change to the gold.
(8) Raise the pH of the HRP solution to pH = 9.0 by the addition of 0.2 M NaCarbonate buffer, pH 9.5 (try an aliquot of 0.05 ml).
(9) Mix with the antibody solution (8 mg of IgG in 1 ml), which has been pre-dialyzed to 0.01 M NaCarbonate buffer, pH 9.0 overnight.
(10) Incubate the mixture for 2 hr at room temperature.
(11) Put freshly prepared 0.1 ml, 0.1 M NaHBr4 in water to the solution.
(12) Incubate at 4 degree for 2 hr.
(13) Put the mixture into a dialysis tube and dialyze against PBS overnight.
(14) Now the conjugate solution is ready for use. Add thimerosal to a final concentration of 0.02% for preservation. Add glycerol to a final concentration of 10% (optional). If you stock the conjugate solution for a long period such as years, stock it at -80 degree. But, in this case, don't repeat freeze.
thaw. You can stock the solution at 4 degree at least 6 months.
3.5 Preparation of ELISA Plate: This will take 2 hr to overnight. Overnight is preferable.
(1) Dilute antibody (IgG) by Plate buffer: 5 to 10 micro-g/ml.
(2) Put the diluted antibody solution, 0.1 ml to the wells of 96-well ELISA plate.
(3) Incubate for 2 hr at room temperature or overnight at 4 degree.
(4) Discard the solution and wash the plate three times by washing buffer. Put 200 micro-l into wells using micro-pipette or just put the Washing buffer using some devices.
(5) Discard the Washing buffer by tapping against paper towel.
(6) Put 0.15 to 0.2 ml of reaction buffer. Now, the plate is ready for use. You can stock the plate at least for 6 months. Take care not to dry up the plate.
3.6 Using Monoclonal Antibodies:
(1) Antibody purification: Antibody purification step is the only special part comparing with materials and methods in using polyclonal antibody. For most monoclonals, except for IgM, Protein G column will be good for the practical use. If you failed by this method, confirm your procedure again before proceeding to the other methods such as DEAE column. When your monoclonal antibody is IgM, try Protamine column combined with molecular sieving column. Others are the same as above mentioned in "Using polyclonal antibodies.
(2) Try skim milk (any kind of powdered milk such as powdered milk for babies) instead of BSA: It's really cheap! Try 1% to 3%. It will decrease the background!! Thing is stability. It will form precipitate if you keep it for a few months. If you are running many plates, it is good alternative.

Correspondence to:
Hongbao Ma
138 Service Road, B410 Clinical Center
Michigan State University
East Lansing, MI 48824
Telephone: 517-432-0623; Email: hongbao@msu.edu

NEW TECHNOLOGY IN AUTISM DETECTION

Accoding to recent studies, a new type of genetic tests to detect abnormalities in children genes that lead to autism is said to be more accurate than standard tests that have been used before.

In this study, experts give three choices of tests on 933 people aged 13-22 years who had been diagnosed with autism. The three types of tests are, the G-banded karyotype test, chromosomal microarray analysis (CMA), and fragile X testing. Those three test is a type of test that is widely used.

Karyotype tests identify aberration chromosome associated with autism as much as 2 percent, while the fragile X genetic mutations found in 0.5 percent of patients. While CMA successfully detect chromosomal abnormalities more than 7 percent of the patients. Differences significant results was assessed to have greater levels of accuracy. Therefore, the experts suggested that CMA became the first test to determine the syndrome of autism in children.

The purpose of the genetic tests done on autistic children is to help parents determine will they have a child who is also autistic or not if their get pregnant again.

If the tests find abnormal chromosomes in the child, parents also need to do tests. If you found the abnormal gene, could be concluded that it is a high-risk that the parents will have children with autism again. However, if you find normal gene, there may be some duplication, so the risk of having autistic children is lower.

“In most cases, we believe there are at least a genetic predisposition to the occurrence of autism, but the ability of existing tests to identify specific genes is difficult because the technology does not exist. In addition, experts generally are not able to determine precisely the genetic mechanisms which trigger autism, “said Dr. Robert Marion, children geneticist from Montefiore Medical Center, New York, United States.

Today the practical standard to test whether a child suffers from autism are two types of genetic tests, karyotype and fragile X testing, which has been known since the 1960s.

Like karyotyping, CMA also sees an abnormal chromosome, but 100 times more accurate. CMA can recognize DNA duplication submicroscopic called re-number variants associated with autism.

Chromosome can be compared in a library and each book is his genes. “What we are looking for is a book which has a missing cover which describe the loss of an extra chromosome or chromosomal fragment containing the gene with autism,” said Dr. David Miller, a genetic expert.

Even so, there are still many things that can not be revealed by genetic experts. As many as 10-15 percent of cases of autism are not derived from a genetic disorder. Everything is still mysterious.

STEP BY STEP IMMUNOHISTOCHEMISTRY

Day 1.

1 ) Preparing the slides

- Deparafinize slides in Xylene x2 15-20 min ea.

Rehydrate

- 100% Ethanol, 2 min

- 100% Ethanol, 2 min

- 95% Ethanol, 2 min

- 95% Ethanol, 2 min

- 70% Ethanol, 2 min

- Milipore Water, 5 min

2) Antigen Unmasking

- 0.1% Trypsin (in 1x TBS) 5-20 min. at RT (200ml TBS 1X and .2 g Trypsin)

* (I usually do 15 min.)

3) Block Endogenous peroxidase activity

- Prepare 1% H2O2 in milipore water for 15 min. RT gentle shaking

4) Blocking/Primary Ab

- Pour off H2O2 and fill with TT buffer; wash in TT buffer 3x5min, RT, gentle shaking. Dry off buffer around sample (do NOT let sample dry or touch it with paper towel) and draw barrier around sample area with PAP pen. Keep slides in TT before and after drawing barrier

- Lay slides flat in humidified chamber (slide box w/wet paper towels) and add blocking buffer (in fridge). Shake gently for 20 min. RT

- Dilute primary Ab in blocking buffer

- Tip off blocking buffer and add 250-400ul of diluted antibody (or blocking buffer for neg control) incubate 15-20 min at RT then O/N at 4*C

Day 2

5) Secondary Ab

- Wash sections with TT buffer 4x5min. Do not cross contaminate the samples (ie neg control w/ Ab)

- Dilute secondary Ab 1:200 with TT buffer (NOT blocking buffer)

- Add 250-400ul diluted secondary Ab to each slide, incubate for 40 min. at RT, gentle shaking (prepare ABC while incubating)

6) ABC-HRP

- While secondary is incubating, prepare the ABC reagent- it must sit after mixing for at least 30-40 min, but try to make it no more than an hour ahead of time

* PBS 2.5ml

*Solution A 1 drop (biotin-avidin, 50ul), mix well, then

*Solution B 1 Drop (HRP, 50ul). Mix well

- Wash sections with TT buffer 3x 5min each.

- Add 250-400 ul of ABC-HRP to each slide. Incubate for 40 min (in humidified box) with genetle shaking

7.) DAB Reaction

- Wash sections 3x 5min with TT buffer

- Wash sections once with milipore water, and prepare fresh DAB substrate from Vector Kit. You can add nickel to the substrate, which makes the peroxidiase rxn gray/black instead of brown. However, we have found that the brown stain makes it easier to distinguish real staining from the background that often associates with blood cells within tumor sections:

o ddH2O 5.0 ml

o Buffer stock 2 drops

o DAB 4 drops

o H2O2 2 drops

o Nickel (optional) 2 drops

- lay slides flat on a paper towel or bench paper, and apply DAB substrate, 250-400 ul. Let rxn run 2-10 min. away from direct light. Monitor staining in microscope. Approximate development time must be determined empirically,

- Rinse with distilled water 2-3 times, 5min each

8) Counterstain/Dehydrate/ClearMount

- Counterstain with Hematoxylin for 1sec dip in staining dish. Filter Hematoxylin through whatman paper before using

- Rinse extensively with tap water

- Dehydrate (100% EtOH x 2) and clear with Xylene (1-2 min x2) Keep in Xylene until coverslip is mounted

- Mount with permount

SEQUENCING DNA IS EASY

DNA sequencing reactions are just like the PCR reactions for replicating DNA (refer to the previous page DNA Denaturation, Annealing and Replication). The reaction mix includes the template DNA, free nucleotides, an enzyme (usually a variant of Taq polymerase) and a 'primer' - a small piece of single-stranded DNA about 20-30 nt long that can hybridize to one strand of the template DNA.

The reaction is initiated by heating until the two strands of DNA separate, then the primer sticks to its intended location and DNA polymerase starts elongating the primer. If allowed to go to completion, a new strand of DNA would be the result. If we start with a billion identical pieces of template DNA, we'll get a billion new copies of one of its strands.



Dideoxynucleotides: We run the reactions, however, in the presence of a dideoxyribonucleotide. This is just like regular DNA, except it has no 3' hydroxyl group - once it's added to the end of a DNA strand, there's no way to continue elongating it.

Now the key to this is that MOST of the nucleotides are regular ones, and just a fraction of them are dideoxy nucleotides.

Replicating a DNA strand in the presence of dideoxy-T

MOST of the time when a 'T' is required to make the new strand, the enzyme will get a good one and there's no problem. MOST of the time after adding a T, the enzyme will go ahead and add more nucleotides. However, 5% of the time, the enzyme will get a dideoxy-T, and that strand can never again be elongated. It eventually breaks away from the enzyme, a dead end product.

Sooner or later ALL of the copies will get terminated by a T, but each time the enzyme makes a new strand, the place it gets stopped will be random. In millions of starts, there will be strands stopping at every possible T along the way.

ALL of the strands we make started at one exact position. ALL of them end with a T. There are billions of them ... many millions at each possible T position. To find out where all the T's are in our newly synthesized strand, all we have to do is find out the sizes of all the terminated products!




Here's how we find out those fragment sizes.

Gel electrophoresis can be used to separate the fragments by size and measure them. In the cartoon at left, we depict the results of a sequencing reaction run in the presence of dideoxy-Cytidine (ddC).

First, let's add one fact: the dideoxy nucleotides in my lab have been chemically modified to fluoresce under UV light. The dideoxy-C, for example, glows blue. Now put the reaction products onto an 'electrophoresis gel' (you may need to refer to 'Gel Electrophoresis' in the Molecular Biology Glossary), and you'll see something like depicted at left. Smallest fragments are at the bottom, largest at the top. The positions and spacing shows the relative sizes. At the bottom is the smallest fragment that's been terminated by ddC; that's probably the C closest to the end of the primer (which is omitted from the sequence shown). Simply by scanning up the gel, we can see that we skip two, and then there's two more C's in a row. Skip another, and there's yet another C. And so on, all the way up. We can see where all the C's are.


Putting all four deoxynucleotides into the picture:

Well, OK, it's not so easy reading just C's, as you perhaps saw in the last figure. The spacing between the bands isn't all that easy to figure out. Imagine, though, that we ran the reaction with *all four* of the dideoxy nucleotides (A, G, C and T) present, and with *different* fluorescent colors on each. NOW look at the gel we'd get (at left). The sequence of the DNA is rather obvious if you know the color codes ... just read the colors from bottom to top: TGCGTCCA-(etc).

(Forgive me for using black - it shows up better than yellow).



An Automated sequencing gel:

That's exactly what we do to sequence DNA, then - we run DNA replication reactions in a test tube, but in the presence of trace amounts of all four of the dideoxy terminator nucleotides. Electrophoresis is used to separate the resulting fragments by size and we can 'read' the sequence from it, as the colors march past in order.

In a large-scale sequencing lab, we use a machine to run the electrophoresis step and to monitor the different colors as they come out. Since about 2001, these machines - not surprisingly called automated DNA sequencers - have used 'capillary electrophoresis', where the fragments are piped through a tiny glass-fiber capillary during the electrophoresis step, and they come out the far end in size-order. There's an ultraviolet laser built into the machine that shoots through the liquid emerging from the end of the capillaries, checking for pulses of fluorescent colors to emerge. There might be as many as 96 samples moving through as many capillaries ('lanes') in the most common type of sequencer.

At left is a screen shot of a real fragment of sequencing gel (this one from an older model of sequencer, but the concepts are identical). The four colors red, green, blue and yellow each represent one of the four nucleotides.

The actual gel image, if you could get a monitor large enough to see it all at this magnification, would be perhaps 3 or 4 meters long and 30 or 40 cm wide.



A 'Scan' of one gel lane:

We don't even have to 'read' the sequence from the gel - the computer does that for us! Below is an example of what the sequencer's computer shows us for one sample. This is a plot of the colors detected in one 'lane' of a gel (one sample), scanned from smallest fragments to largest. The computer even interprets the colors by printing the nucleotide sequence across the top of the plot. This is just a fragment of the entire file, which would span around 900 or so nucleotides of accurate sequence.

The sequencer also gives the operator a text file containing just the nucleotide sequence, without the color traces.


As you have seen, we can get the sequence of a fragment of DNA as long as 900 or so nucleotides. Great! But what about longer pieces? The human genome is 3 *billion* bases long, arranged on 23 pairs of chromosomes. Our sequencing machine reads just a drop in the bucket compared to what we really need!

To do it, we break the entire genome up into manageable pieces and sequence them. There are two approaches currently in use:

* The Publically-funded Human Genome Project: The National Institutes of Health and the National Science Foundation have funded the creation of 'libraries' of BAC clones. Each BAC carries a large piece of human genomic DNA on the order of 100-300 kb. All of these BACs overlap randomly, so that any one gene is probably on several different overlapping BACs. We can replicate those BACs as many times as necessary, so there's a virtually endless supply of the large human DNA fragment.

In the Publically-funded project, the BACs are subjected to shotgun sequencing (see below) to figure out their sequence. By sequencing all the BAC's, we know enough of the sequence in overlapping segments to reconstruct how the original chromosome sequence looks.

* A Privately-Funded Sequencing Project: Celera Genomics An innovative approach to sequencing the human genome has been pioneered by Celera Genomics. The founders of this company realized that it might be possible to skip the entire step of making libraries of BAC clones. Instead, they blast apart the entire human genome into fragments of 2-10 kb and sequence those. Now the challenge is to assemble those fragments of sequence into the whole genome sequence.

Imagine, for example that you have hundreds of 500-piece puzzles, each being assembled by a team of puzzle experts using puzzle-solving computers. Those puzzles are like BACs - smaller puzzles that make a big genome manageable. Now imagine that Celera throws all those puzzles together into one room and scrambles the pieces. They, however, have scanners that scan all the puzzle pieces and huge computers that figure out where they all go.

It is controversial still as to whether the Celera approach will succeed on a puzzle as large as the human genome. Whether it does or not, they have certainly stirred up the intellectual pot a bit.



Shotgun sequencing: assembly of random sequence fragments
To sequence a BAC, we take millions of copies of it and chop them all up randomly. We then insert those into plasmids and for each one we get, we grow lots of it in bacteria and sequence the insert. If we do this to enough fragments, eventually we'll be able to reconstruct the sequence of the original BAC based on the overlapping fragments we've sequenced!

THE CHROMOSOMAL BASIS OF MAMMALIAN SEX DETERMINATION

In 1916, Bridges described the sex chromosomes of the fruit fly Drosophila melanogaster, ascribing the sex
determining mechanism to the X:autosome ratio, i.e.,2:2 in females (XX), 1:2 in males (XY). When the human
X and Y chromosomes were first described by Painter (177), it was initially thought that humans would have a
similar mechanism. Another 30 years elapsed before the first sex chromosome aneuploid mammals were
discovered, which overturned this hypothesis and conclusively demonstrated that mammalian sex determination
is dependent on the Y chromosome. In humans, XXY individuals develop testes (103) and XO individuals
develop ovaries (75). Consequently, if sex were determined by the X:autosome ratio, the reverse would
have been true. In the following three decades it became increasingly obvious that development of testes is associated with the presence of a single Y-linked gene locus, dubbed TDF (testis determining factor) in humans and Tdy in mice. For simplicity, we will refer to both as TDY. As in all genetic analysis, this understanding arose out of the examination of mutations both in human and mouse that led to varying degrees of sex reversal, i.e., the chromosomal sex does not correlate with the observed sex. However, sterility is also usually a consequence of sex-reversing mutations, and therefore, such cases are generally sporadic, making conventional pedigree-based positional mapping difficult or impossible. Identification of TDY therefore had to rely on the study of sporadic cases of sex reversal

Quantitative TaqMan Real-Time PCR Diagnostic and Scientific Applications

Jörg Dötsch1, Ellen Schoof1 and Wolfgang Rascher1
(1) Department of Pediatrics, University of Erlangen, Erlangen, Germany

1 Principles of TaqMan Real-Time PCR
The use of the TaqMan reaction has been described in a number of original and review articles (3–5). This approach makes use of the 5′ exonuclease activity of the DNA polymerase (AmpliTaq Gold). Briefly, within the amplicon defined by a gene-specific PCR primer pair, an oligonucleotide probe labeled with two fluorescent dyes is created, designated as the TaqMan probe. As long as the probe is intact, the emission of the reporter dye (i.e., 6-carboxy-fluorescein, FAM) at the 5′ end is quenched by the second fluorescence dye (6-carboxy-tetramethyl-rhodamine, TAMRA) at the 3′ end. During the extension phase of PCR, the polymerase cleaves the TaqMan probe, resulting in a release of reporter dye. The increasing amount of reporter dye emission is detected by an automated sequence detector combined with a dedicated software (ABI Prism 7700 Sequence Detection System, Perkin-Elmer, Foster City, CA). The algorithm normalizes the reporter signal (Rn) to a passive reference. Next, the algorithm multiplies the standard deviation of the background Rn in the first few cycles (in most PCR systems, cycles 3-15, respectively) by a default factor of 10 to determine a threshold. The cycle at which this baseline level is exceeded is defined as the threshold cycle (Ct) (see Fig. 1 ). Ct has a linear relation with the logarithm of the initial template copy number. Its absolute value additionally depends on the efficiency of both DNA amplification and cleavage of the TaqMan probe. The Ct values of the samples are interpolated to an external reference curve constructed by plotting the relative or absolute amounts of a serial dilution of a known template vs the corresponding Ct values. The oligonucleotides of each target of interest can be designed by the Primer Express software (Perkin-Elmer) using uniform selection parameters.
MediaObjects/978-1-59259-870-0_23_Fig1_HTML.jpg
Fig. 1. Sketch of the principle of TaqMan PCR for the quantification of gene expression. By measuring the amplicon concentration in the early exponential phase of the PCR reaction, the exhaustion of reagents is avoided. (Modified from ref. 3.)
2 Reliability and Validation of TaqMan Real-Time PCR

The use of TaqMan real-time PCR for the quantification of gene expression has been shown to be at least as reliable as the application other quantitative PCR techniques, like competitive PCR (6,7). Whereas the expression of highly expressed genes like the housekeeping gene glyceraldehyde-3-phosphate is well correlated between the two methods, for the determination of genes with lower expression like the neuropeptide Y TaqMan PCR is much more sensitive than competitive PCR (6) (see Fig. 2 ). In addition, the spectrum of linear measurements for realtime PCR is in the range of 106, in contrast to 102 in competitive RT-PCR. Finally, a considerably higher number of samples per day can be measured by real-time PCR (up to 400 measurements). In comparison to the Northern blot assessment, only a minimal fraction of mRNA is necessary to quantify gene expression by real-time PCR (8,9). RNA can be extracted using standard techniques like commercial RNA isolation kits (e.g., RNAzol-B isolation kit; WAK-Chemie Medical GmbH, Bad Homburg, Germany) or conventional phenol-chloroform extraction for DNA (10).
3 Applications for TaqMan Real-Time PCR

A number of applications for TaqMan real-time PCR have been introduced in the last few years, the most important being the quantification of gene expression. Some of the most important applications and potential applications will be discussed below.
3.1 Quantification of Gene Expression
Quantification of gene expression has been facilitated to a considerable degree by the use of real-time techniques such as TaqMan PCR. This technique has practically replaced less sensitive and more time-consuming methods such as Northern blot or RNAse protection assay. Quantitative competitive PCR (7) is less effective and less sensitive as well (6). Crucial aspects in the measurements of gene expression by real-time PCR are the preparation of RNA especially in samples that only contain small amounts of the specific mRNA, such as single-cell picking or microdissection (see Subheading 7 .). On the other hand, quantification can be difficult; in general, housekeeping genes can be applied (e.g., by using duplex approaches). Alternatively, external standards can be considered (11).
MediaObjects/978-1-59259-870-0_23_Fig2_HTML.jpg
Fig. 2. Relation of gene expression as assessed by competitive quantitative and TaqMan real-time PCR. (A) mRNA expression of GAPDH. r = 0.92, p< 0.001. (B) mRNA expression of NPY. r = 0.87, p< 0.001 (Adapted from ref. 6.)
In most cases of mRNA quantification, gene expression has to be related to housekeeping genes that are expressed relatively stable throughout the cells. In the studies performed on gene expression in neuroblastomas so far, three different housekeeping genes have been assessed: the more traditional genes glyceraldehyde-3-phosphate (GAPDH) (6) and β-actin (10) and the neuronal marker protein gene product 9.5 (PGP9.5) (6). One major general difficulty in the use of housekeeping genes for the determination of mRNA transcript ratios is the possibility that their expression might also be altered by coexpression of pseudogenes and environmental changes (e.g., by hypoxia in case of GAPDH) (12). Pseudogenes can be eliminated using primer combinations that are intron spanning. However, unidentified influences cannot be dealt with as easily. Therefore, we used at least two housekeeping genes for quantification of mRNA expression. However, this aspect clearly needs further evaluation. In our group, a number of primers and TaqMan probes have been used for housekeeping gene amplification (6,13) ( Table 1 ).

Table 1

Primers and TaqMan Probes Used for the Quantification of Human Housekeeeping Gene Expression

\gb-Actin


Probe


CCAGCCATGTACGTTGCTATCCAGGC


Forward


GCGAGAAGATGACCCAGGATC


Reverse


CCAGTGGTACGGCCAGAGG

GAPDH


Probe


CCTCAACTACATGGTTTACATGTTCCAATATGATTCCAC


Forward


GCCATCAATGACCCCTTCATT


Reverse


TTGACGGTGCCATGGAATTT

PBGD


Probe


CTTCGCTGCATCGCTGAAAGGGC


Forward


TGTGCTGCACGATCCCG


Reverse


ACACTGCAGCCTCCTTCCAG

HPRT


Probe


CGCAGCCCTGGCGTCGTGATTA


Forward


CCGGCTCCGTTATGGC


Reverse


GGTCATAACCTGGTTCATCATCA

\gb2MG


Probe


TGATGCTGCTTACATGTCTCGATCCCA


Forward


TGACTTTGTCACAGCCCAAGATA


Reverse


CCAAATGCGGCATCTTC

Abbreviations: GAPDH: glyceraldehyd-3-phosphate dehydrogenase, PBGD: porphobilinogen deaminase, HPRT: hypoxanthine-guanine-phosphoribosyl-transferase, \gb2MG: \gb2-microglobulin.

Source: Data from refs. 6and 13-15.
3.2 Quantification of Gene Copy Number, Determination of Minimal Residual Disease, and Allelic Discrimination in Malignant Tumors
3.2.1 MYCN Detection by TaqMan PCR in Neuroblastoma Tissue

DNA copy number, MYCN amplification in neuroblastomas, is of great potential interest with regard to the prognosis of disease. In fact, in clinical practice, MYCN gene expression correlates with both advanced disease stage (16) and rapid tumor progression (17).

Several methods have been used for the detection of MYCN detection mainly based on Southern or dot blot (18,19), on quantitative PCR (20), and on fluorescent in situ hybridization techniques (21). The use of most PCR methods is restricted, however, by the fact that end-point measurements are used for quantification. Therefore, Raggi and co-workers (10) introduced a TaqMan real-time base method for the determination of MYCN amplification in neuroblastomas. The authors demonstrate a precise assay with an interassay coefficient of variation of 13‰ and an intraassay coefficient of variation of 11‰. The threshold cycle for the detection of MYCN correlates in an inverse linear way with the logarithm of the input of genomic DNA molecules. There is a good linear relationship between the MYCN amplification measured by TaqMan real-time PCR and competitive PCR. Using Kaplan-Meier survival curves, the authors showed that the amplification of MYCN as assessed by TaqMan real-time PCR is closely linked to cumulative survival, as this had already been demonstrated with several other techniques for the quantification of MYCN amplification.
3.2.2 Minimal Residual Disease

Another important aspect of real-time PCR in the field of oncology is the detection of minimal residual disease that is 100- to 1000-fold more sensitive than traditional methods. As few as five copies can be detected in one reaction (11), but the maximal input of DNA during sample preparation is the limiting step. This limitation must, therefore, be considered when looking for minimal residual disease in malignant diseases such as childhood or adulthood acute lymphoblastic leukemia (22,23).

Various methods have been used to study tumor cytogenetic aberrations in malignant tumors for clinical decision-making. Initially, conventional cytogenetic techniques were applied. Karyotyping by conventional cytogenetics, however, depends on dividing cells, and successful evaluations are often hampered by inferior metaphase quality. Following this, restriction fragment length polymorphisms (RFLPs), PCR-based microsatellite, and fluorescence in situ hybridization (FISH) analyses have been applied to overcome the restrictions of conventional cytogenetics. However, RFLP- and PCR-based microsatellite analyses depend on informative loci in the region of interest and the need for normal reference DNA of the respective patient, whereas FISH analyses are sometimes hampered by inferior tissue quality and hybridization probe availability. The latest technique used for routine detection of cytogenetic aberrations is comparative genomic hybridization CGH (24). CGH has proved to be consecutively applicable to tumor specimens for the detection of most aberrations known from conventional cytogenetics, but deletions of smaller DNA regions might be undetectable. Thus, this technique should be used to prescreen tumor samples for gross cytogenetic aberrations and be supplemented by a TaqMan PCR-based approach to detect loss or gain of DNA on the single-gene level.
3.3 Pathogene Detection and Quantification

Real-time PCR can be of great benefit in the detection and quantification of pathogens such as viruses, bacteria, and fungi. The method proves to be useful in the use for environmental detection (25) and in infected patients.

Several difficulties, however, can occur (11). In contrast to traditional methods of microbiology, vital and dead microorganisms are both detected. Second, most infectious organisms are characterized by a high mutation rate, which might influence the estimation of viral or bacterial load dramatically (26). Finally, quantification necessitates the use of reliable standards. This can be achieved by using duplex or multiplex assays (27). To assure permanent quality and the possibility of comparing results, international standardization will have to be obtained in the future.
4 Limitations and Pitfalls in the Use of TaqMan Real-Time PCR

The use of TaqMan PCR can be particularly difficult if gene expression at a low level is to be quantified. One major pitfall in this context is the accidental determination of genomic DNA when RT-PCR is intended. There are various approaches to meet this problem: It is always useful to select primer combinations that are intron spanning (2). If there is no possibility to select intron-spanning primers, RNA samples can be pretreated with DNAse. However, this measure should not be chosen routinely and can also be deleterious if only small amounts of RNA are present that are partially destroyed as well (28).

One other difficulty is the high degree of technical expertise that is required to achieve as low a variation coefficient and as sensitive a measurement as possible. It could be shown that the degree of technical expertise can alter the gene level that is measured by up to 1000-fold (28). Because real-time PCR is highly sensitive, the risk of having interference with minor contamination is quite considerable. On the other hand, the risk of false-negative results must not be underestimated because post-hoc PCR steps are not “visible” to the degree that is provided by the more traditional methods for gene quantification (11).
5 Alternative Real-Time PCR Methods

There are other methods for real-time PCR not relying on exonuclease cleavage of a specific probe to generate a fluorescence signal. One of them, the LightCycler System (Roche Molecular), makes use of so-called “hybridization probes” (29,30). Like exonuclease probes, hybridization probes are used in addition to the PCR primers. However, unlike the first, hybridization probes combine two different fluorescent labels to allow resonance energy transfer. One of them is activated by external light. When both probes bind very closely at the DNA molecules generated by the PCR-amplification process, the emitted light from the first dye activates the fluorescent dye of the second probe. This second dye emits light with a longer wavelength, which is measured every cycle. Thus, the fluorescence intensity is directly correlated to the extent of probe hybridization and, subsequently, directly related to the amount of PCR product. A major advantage of the LightCycler is the very short time of the PCR run. However, the TaqMan system allows one to analyze a higher number of samples at one time and, at least theoretically, might be more accurate, as there is an internal reference dye to monitor minor variations in sample preparation.

Apart from exonuclease and hybridization methods for real-time PCR, there are other options, including hairpin probes, hairpin primers, and intercalating fluorescent dyes. Hairpin probes, also known as molecular beacons, contain reverse complement sequences at both ends binding together while the rest of the strand remains single stranded, creating a panhandlelike structure. In addition, there are fluorescent dyes at both ends of the molecule: a reporter and a quencher similar to the TaqMan probes. In the panhandlelike conformation, there is no fluorescence, as the fluorescent reporter at one end and the quencher at the other end of the probe are very close to one another (31). As the central part of a molecular beacon consists of a target-specific sequence, both ends are separated from each other when this part of the molecule is bound to the PCR product and a fluorescence signal can be emitted from the reporter dye. Hairpin primers, also named “amplifluor primers,” are similar to molecular beacons, but fluorescence is generated as they become incorporated into the double-stranded PCR product during amplification. Another very simple technique for monitoring the generation of PCR product in a real-time fashion is the use of intercalating dyes, such as EtBr and SYBR green I, which do not bind to single-stranded DNA but to the double-stranded PCR product (30,32). However, hairpin primers and intercalating dyes do not offer the high specificity of the probe-based techniques and a positive signal might even be generated by primer dimers.
6 Future Developments

From a diagnostic point of view, one interesting aspect for the future might be the use of semiautomated or automated real-time devices for the assessment of gene expression and amplification, putting into consideration the relatively easy and low time-consuming method of measurement. For diseases such as neuroblastoma, real-time PCR might help to quantify more prognostic markers like the nerve growth factor receptor (TRKA gene) (33), the expression of genes involved in multidrug resistance (MDR1 and MRP) (34,35), and genes related to tumor invasion and metastasis (nm23 and CD44) (36,37). There are first reports on the use of multiplex real-time PCR, a development that is certainly going to facilitate diagnostic procedure in the next 5 yr (38,39).

From a research point of view, real-time PCR might facilitate the identification of new prognostic markers, because a large number of samples can be processed in a relatively short time (40,41). Another future application of TaqMan PCR is the confirmation of results obtained by cDNA microarrays, which will be abundantly used for cDNA screening. Of particular interest might be the chance to determine gene expression in very few cells using single-cell picking (42,43). Using this approach, not only can minimal involvement of tumor cells be visualized but also nonhomogenous distributions in malignant tumor might be monitored with respect to essential prognostic markers. It is of importance that in situ gene expression after laser capture microdissection might not only be performed in frozen sections but also from formalin-fixed and paraffin-embedded biopsies (44).
7 Conclusions TaqMan real-time PCR provides a reliable technology for the quantification of gene expression. However, a number of preconditions have to be met for each new marker. First, the system parameters reflecting amplification efficiency (slope) and linearity should match the minimal requirements. This should include the calculation of the intra-assay and interassay coefficient of variation with regard to the threshold cycle at which the amplification signal is detected. Second, the assay itself should be carefully evaluated with regard to a linear relationship between threshold cycle and the logarithm of a serial dilution of a reference sample. Third, real-time PCR results should be compared with a second, independent method for quantification, like quantitative competitive PCR. Finally, it should be assessed whether the results obtained with regard to clinical outcome represent the experiences obtained with other methods for gene detection.

Apart from a high degree of precision, practical advantages of real-time PCR are easy handling, rapid measurements, and a broad linear range for the measurements. Whereas competitive PCR only allows for the determination of few samples in one assay, TaqMan real-time PCR provides the opportunity to measure more than 80 samples at one time in a 96-well plate together with the control reactions needed.

SOURCE : http://www.springerlink.com/content/g6h3214l36011k1g/fulltext.html

Analyzing the Genome One Cell at a Time

Gene Expression and DNA Sequence Analysis at the Single-Cell Level Reveal Heterogeneity.

Early studies of gene expression in single cells revealed a greater than expected amount of heterogeneity among cells from supposedly homogeneous populations. It is now well accepted that, for example, not every tumor cell, liver cell, or stem cell isolated from a distinct population will be identical in terms of which genes are expressed and at what levels.

Simply averaging the transcription levels measured across multiple individual cells will not accurately convey what is taking place in any one cell. Furthermore, this approach may result in an especially interesting and biologically or clinically relevant characteristic of one or more of the cell subtypes present in a cell population to be missed if their genomic heterogeneity is not analyzed and understood.

The desire to characterize this variability in gene expression across cells and to acquire genomic sequence data on a single-cell level is driving advances in the field of single-cell genomics, which is part of a broader field of single-cell analysis that is benefiting from an emerging trend to develop and apply tools and technologies for robust, high-throughput, and reproducible analysis of biological function at the single-cell level.

Initial focus areas include developmental biology and cancer and stem cell research; early commercial applications relate to embryo screening for in vitro fertilization (IVF) procedures, characterization and drug-response testing of circulating tumor cells, and infectious-disease diagnostics. Single-cell genomic analysis was a key area of discussion at Select Biosciences’ “Single Cell Analysis Summit” held recently in San Diego.

In reality, “most cells have very few transcripts, and a few cells have a lot of gene expression,” explained Mikael Kubista, Ph.D., CEO of Tataa Biocenter. Gene expression is a highly dynamic process, occurring in bursts of active transcription followed by less active periods during which existing mRNA transcripts decay.

“We have found that these bursts generally do not correlate from cell to cell,” Dr. Kubista said. This led the company to develop its single-cell transcription correlation platform, in which identification of a cell type is not based on the level of any particular transcript, but rather on correlations of transcription.

Using single-cell expression correlation, it is possible to distinguish between two or more subtypes of cells within a population that express the same transcripts. They differ not in the presence or absence of a particular transcript, but in the pattern of gene-expression levels. One way Tataa is applying this technology is to study circulating tumor cells, with a clinical goal of identifying what clones are present in a patient’s blood and to which chemotherapeutic agents they may/may not respond.

Tataa developed a technique for measuring intracellular mRNA gradients using qPCR and applies it to the study of gene-expression heterogeneity at the single-cell and subcellular level. To capture mRNA transcripts from a single cell without significant loss of material, Tataa formulated a set of detergents to facilitate cell lysis and mRNA removal without the need for washing steps. It licensed the detergents to Roche, which incorporated them into its RealTime Ready Cell Lysis Kit.

Dr. Kubista identified three main challenges at present for single-cell gene-expression analysis including the need for robust single-cell isolation techniques, increased throughput, and improved tools for data mining and multivariate data analysis.

Steven Bodovitz, Ph.D., principal at Bioperspectives, defined the opportunity in this field as the ability to “transform cellular heterogeneity from a source of noise into a source of new discoveries.”

The reasons to do so are “compelling,” he said. For example, if an easy and more reliable method was available to identify the different cell subtypes in a tumor, could a more effective, multitargeted chemotherapeutic approach be developed?

Dr. Bodovitz identified two main drivers of single-cell omics research: the potential biological significance of understanding cell heterogeneity, and the enabling technological advances including miniaturization, microfluidics, and whole-genome amplification (WGA) techniques that yield enough DNA from a single cell to enable genomic analysis using available gene-expression analysis or next-generation sequencing (NGS) methods.

When asked to identify the main challenge the field of single-cell genomics currently faces, Dr. Bodovitz pointed to the need for improved methods of isolating single cells from tissue samples. “One tends to destroy the cell to analyze it.”

Whereas perturbations to a cell are unlikely to affect the results of genetic or epigenetic analysis, as these characteristics should remain stable, cellular disruption could affect gene-expression analysis and other types of omics studies. Intentional perturbation of a single cell represents an “elegant system” for studying biological pathways and intracellular networks based on the up- or downregulation of gene expression, added Dr. Bodovitz. This knowledge could be used to guide the design of drugs capable of interfering in a particular pathway.

http://genengnews.com/gen-articles/analyzing-the-genome-one-cell-at-a-time/3497/