Home | Looking for something? Sign In | New here? Sign Up | Log out
Showing posts with label real time PCR principle. Show all posts
Showing posts with label real time PCR principle. Show all posts

Tuesday, January 11, 2011

Quantitative TaqMan Real-Time PCR Diagnostic and Scientific Applications

Tuesday, January 11, 2011
0 comments

Jörg Dötsch1, Ellen Schoof1 and Wolfgang Rascher1
(1) Department of Pediatrics, University of Erlangen, Erlangen, Germany

1 Principles of TaqMan Real-Time PCR
The use of the TaqMan reaction has been described in a number of original and review articles (3–5). This approach makes use of the 5′ exonuclease activity of the DNA polymerase (AmpliTaq Gold). Briefly, within the amplicon defined by a gene-specific PCR primer pair, an oligonucleotide probe labeled with two fluorescent dyes is created, designated as the TaqMan probe. As long as the probe is intact, the emission of the reporter dye (i.e., 6-carboxy-fluorescein, FAM) at the 5′ end is quenched by the second fluorescence dye (6-carboxy-tetramethyl-rhodamine, TAMRA) at the 3′ end. During the extension phase of PCR, the polymerase cleaves the TaqMan probe, resulting in a release of reporter dye. The increasing amount of reporter dye emission is detected by an automated sequence detector combined with a dedicated software (ABI Prism 7700 Sequence Detection System, Perkin-Elmer, Foster City, CA). The algorithm normalizes the reporter signal (Rn) to a passive reference. Next, the algorithm multiplies the standard deviation of the background Rn in the first few cycles (in most PCR systems, cycles 3-15, respectively) by a default factor of 10 to determine a threshold. The cycle at which this baseline level is exceeded is defined as the threshold cycle (Ct) (see Fig. 1 ). Ct has a linear relation with the logarithm of the initial template copy number. Its absolute value additionally depends on the efficiency of both DNA amplification and cleavage of the TaqMan probe. The Ct values of the samples are interpolated to an external reference curve constructed by plotting the relative or absolute amounts of a serial dilution of a known template vs the corresponding Ct values. The oligonucleotides of each target of interest can be designed by the Primer Express software (Perkin-Elmer) using uniform selection parameters.
MediaObjects/978-1-59259-870-0_23_Fig1_HTML.jpg
Fig. 1. Sketch of the principle of TaqMan PCR for the quantification of gene expression. By measuring the amplicon concentration in the early exponential phase of the PCR reaction, the exhaustion of reagents is avoided. (Modified from ref. 3.)
2 Reliability and Validation of TaqMan Real-Time PCR

The use of TaqMan real-time PCR for the quantification of gene expression has been shown to be at least as reliable as the application other quantitative PCR techniques, like competitive PCR (6,7). Whereas the expression of highly expressed genes like the housekeeping gene glyceraldehyde-3-phosphate is well correlated between the two methods, for the determination of genes with lower expression like the neuropeptide Y TaqMan PCR is much more sensitive than competitive PCR (6) (see Fig. 2 ). In addition, the spectrum of linear measurements for realtime PCR is in the range of 106, in contrast to 102 in competitive RT-PCR. Finally, a considerably higher number of samples per day can be measured by real-time PCR (up to 400 measurements). In comparison to the Northern blot assessment, only a minimal fraction of mRNA is necessary to quantify gene expression by real-time PCR (8,9). RNA can be extracted using standard techniques like commercial RNA isolation kits (e.g., RNAzol-B isolation kit; WAK-Chemie Medical GmbH, Bad Homburg, Germany) or conventional phenol-chloroform extraction for DNA (10).
3 Applications for TaqMan Real-Time PCR

A number of applications for TaqMan real-time PCR have been introduced in the last few years, the most important being the quantification of gene expression. Some of the most important applications and potential applications will be discussed below.
3.1 Quantification of Gene Expression
Quantification of gene expression has been facilitated to a considerable degree by the use of real-time techniques such as TaqMan PCR. This technique has practically replaced less sensitive and more time-consuming methods such as Northern blot or RNAse protection assay. Quantitative competitive PCR (7) is less effective and less sensitive as well (6). Crucial aspects in the measurements of gene expression by real-time PCR are the preparation of RNA especially in samples that only contain small amounts of the specific mRNA, such as single-cell picking or microdissection (see Subheading 7 .). On the other hand, quantification can be difficult; in general, housekeeping genes can be applied (e.g., by using duplex approaches). Alternatively, external standards can be considered (11).
MediaObjects/978-1-59259-870-0_23_Fig2_HTML.jpg
Fig. 2. Relation of gene expression as assessed by competitive quantitative and TaqMan real-time PCR. (A) mRNA expression of GAPDH. r = 0.92, p< 0.001. (B) mRNA expression of NPY. r = 0.87, p< 0.001 (Adapted from ref. 6.)
In most cases of mRNA quantification, gene expression has to be related to housekeeping genes that are expressed relatively stable throughout the cells. In the studies performed on gene expression in neuroblastomas so far, three different housekeeping genes have been assessed: the more traditional genes glyceraldehyde-3-phosphate (GAPDH) (6) and β-actin (10) and the neuronal marker protein gene product 9.5 (PGP9.5) (6). One major general difficulty in the use of housekeeping genes for the determination of mRNA transcript ratios is the possibility that their expression might also be altered by coexpression of pseudogenes and environmental changes (e.g., by hypoxia in case of GAPDH) (12). Pseudogenes can be eliminated using primer combinations that are intron spanning. However, unidentified influences cannot be dealt with as easily. Therefore, we used at least two housekeeping genes for quantification of mRNA expression. However, this aspect clearly needs further evaluation. In our group, a number of primers and TaqMan probes have been used for housekeeping gene amplification (6,13) ( Table 1 ).

Table 1

Primers and TaqMan Probes Used for the Quantification of Human Housekeeeping Gene Expression

\gb-Actin


Probe


CCAGCCATGTACGTTGCTATCCAGGC


Forward


GCGAGAAGATGACCCAGGATC


Reverse


CCAGTGGTACGGCCAGAGG

GAPDH


Probe


CCTCAACTACATGGTTTACATGTTCCAATATGATTCCAC


Forward


GCCATCAATGACCCCTTCATT


Reverse


TTGACGGTGCCATGGAATTT

PBGD


Probe


CTTCGCTGCATCGCTGAAAGGGC


Forward


TGTGCTGCACGATCCCG


Reverse


ACACTGCAGCCTCCTTCCAG

HPRT


Probe


CGCAGCCCTGGCGTCGTGATTA


Forward


CCGGCTCCGTTATGGC


Reverse


GGTCATAACCTGGTTCATCATCA

\gb2MG


Probe


TGATGCTGCTTACATGTCTCGATCCCA


Forward


TGACTTTGTCACAGCCCAAGATA


Reverse


CCAAATGCGGCATCTTC

Abbreviations: GAPDH: glyceraldehyd-3-phosphate dehydrogenase, PBGD: porphobilinogen deaminase, HPRT: hypoxanthine-guanine-phosphoribosyl-transferase, \gb2MG: \gb2-microglobulin.

Source: Data from refs. 6and 13-15.
3.2 Quantification of Gene Copy Number, Determination of Minimal Residual Disease, and Allelic Discrimination in Malignant Tumors
3.2.1 MYCN Detection by TaqMan PCR in Neuroblastoma Tissue

DNA copy number, MYCN amplification in neuroblastomas, is of great potential interest with regard to the prognosis of disease. In fact, in clinical practice, MYCN gene expression correlates with both advanced disease stage (16) and rapid tumor progression (17).

Several methods have been used for the detection of MYCN detection mainly based on Southern or dot blot (18,19), on quantitative PCR (20), and on fluorescent in situ hybridization techniques (21). The use of most PCR methods is restricted, however, by the fact that end-point measurements are used for quantification. Therefore, Raggi and co-workers (10) introduced a TaqMan real-time base method for the determination of MYCN amplification in neuroblastomas. The authors demonstrate a precise assay with an interassay coefficient of variation of 13‰ and an intraassay coefficient of variation of 11‰. The threshold cycle for the detection of MYCN correlates in an inverse linear way with the logarithm of the input of genomic DNA molecules. There is a good linear relationship between the MYCN amplification measured by TaqMan real-time PCR and competitive PCR. Using Kaplan-Meier survival curves, the authors showed that the amplification of MYCN as assessed by TaqMan real-time PCR is closely linked to cumulative survival, as this had already been demonstrated with several other techniques for the quantification of MYCN amplification.
3.2.2 Minimal Residual Disease

Another important aspect of real-time PCR in the field of oncology is the detection of minimal residual disease that is 100- to 1000-fold more sensitive than traditional methods. As few as five copies can be detected in one reaction (11), but the maximal input of DNA during sample preparation is the limiting step. This limitation must, therefore, be considered when looking for minimal residual disease in malignant diseases such as childhood or adulthood acute lymphoblastic leukemia (22,23).

Various methods have been used to study tumor cytogenetic aberrations in malignant tumors for clinical decision-making. Initially, conventional cytogenetic techniques were applied. Karyotyping by conventional cytogenetics, however, depends on dividing cells, and successful evaluations are often hampered by inferior metaphase quality. Following this, restriction fragment length polymorphisms (RFLPs), PCR-based microsatellite, and fluorescence in situ hybridization (FISH) analyses have been applied to overcome the restrictions of conventional cytogenetics. However, RFLP- and PCR-based microsatellite analyses depend on informative loci in the region of interest and the need for normal reference DNA of the respective patient, whereas FISH analyses are sometimes hampered by inferior tissue quality and hybridization probe availability. The latest technique used for routine detection of cytogenetic aberrations is comparative genomic hybridization CGH (24). CGH has proved to be consecutively applicable to tumor specimens for the detection of most aberrations known from conventional cytogenetics, but deletions of smaller DNA regions might be undetectable. Thus, this technique should be used to prescreen tumor samples for gross cytogenetic aberrations and be supplemented by a TaqMan PCR-based approach to detect loss or gain of DNA on the single-gene level.
3.3 Pathogene Detection and Quantification

Real-time PCR can be of great benefit in the detection and quantification of pathogens such as viruses, bacteria, and fungi. The method proves to be useful in the use for environmental detection (25) and in infected patients.

Several difficulties, however, can occur (11). In contrast to traditional methods of microbiology, vital and dead microorganisms are both detected. Second, most infectious organisms are characterized by a high mutation rate, which might influence the estimation of viral or bacterial load dramatically (26). Finally, quantification necessitates the use of reliable standards. This can be achieved by using duplex or multiplex assays (27). To assure permanent quality and the possibility of comparing results, international standardization will have to be obtained in the future.
4 Limitations and Pitfalls in the Use of TaqMan Real-Time PCR

The use of TaqMan PCR can be particularly difficult if gene expression at a low level is to be quantified. One major pitfall in this context is the accidental determination of genomic DNA when RT-PCR is intended. There are various approaches to meet this problem: It is always useful to select primer combinations that are intron spanning (2). If there is no possibility to select intron-spanning primers, RNA samples can be pretreated with DNAse. However, this measure should not be chosen routinely and can also be deleterious if only small amounts of RNA are present that are partially destroyed as well (28).

One other difficulty is the high degree of technical expertise that is required to achieve as low a variation coefficient and as sensitive a measurement as possible. It could be shown that the degree of technical expertise can alter the gene level that is measured by up to 1000-fold (28). Because real-time PCR is highly sensitive, the risk of having interference with minor contamination is quite considerable. On the other hand, the risk of false-negative results must not be underestimated because post-hoc PCR steps are not “visible” to the degree that is provided by the more traditional methods for gene quantification (11).
5 Alternative Real-Time PCR Methods

There are other methods for real-time PCR not relying on exonuclease cleavage of a specific probe to generate a fluorescence signal. One of them, the LightCycler System (Roche Molecular), makes use of so-called “hybridization probes” (29,30). Like exonuclease probes, hybridization probes are used in addition to the PCR primers. However, unlike the first, hybridization probes combine two different fluorescent labels to allow resonance energy transfer. One of them is activated by external light. When both probes bind very closely at the DNA molecules generated by the PCR-amplification process, the emitted light from the first dye activates the fluorescent dye of the second probe. This second dye emits light with a longer wavelength, which is measured every cycle. Thus, the fluorescence intensity is directly correlated to the extent of probe hybridization and, subsequently, directly related to the amount of PCR product. A major advantage of the LightCycler is the very short time of the PCR run. However, the TaqMan system allows one to analyze a higher number of samples at one time and, at least theoretically, might be more accurate, as there is an internal reference dye to monitor minor variations in sample preparation.

Apart from exonuclease and hybridization methods for real-time PCR, there are other options, including hairpin probes, hairpin primers, and intercalating fluorescent dyes. Hairpin probes, also known as molecular beacons, contain reverse complement sequences at both ends binding together while the rest of the strand remains single stranded, creating a panhandlelike structure. In addition, there are fluorescent dyes at both ends of the molecule: a reporter and a quencher similar to the TaqMan probes. In the panhandlelike conformation, there is no fluorescence, as the fluorescent reporter at one end and the quencher at the other end of the probe are very close to one another (31). As the central part of a molecular beacon consists of a target-specific sequence, both ends are separated from each other when this part of the molecule is bound to the PCR product and a fluorescence signal can be emitted from the reporter dye. Hairpin primers, also named “amplifluor primers,” are similar to molecular beacons, but fluorescence is generated as they become incorporated into the double-stranded PCR product during amplification. Another very simple technique for monitoring the generation of PCR product in a real-time fashion is the use of intercalating dyes, such as EtBr and SYBR green I, which do not bind to single-stranded DNA but to the double-stranded PCR product (30,32). However, hairpin primers and intercalating dyes do not offer the high specificity of the probe-based techniques and a positive signal might even be generated by primer dimers.
6 Future Developments

From a diagnostic point of view, one interesting aspect for the future might be the use of semiautomated or automated real-time devices for the assessment of gene expression and amplification, putting into consideration the relatively easy and low time-consuming method of measurement. For diseases such as neuroblastoma, real-time PCR might help to quantify more prognostic markers like the nerve growth factor receptor (TRKA gene) (33), the expression of genes involved in multidrug resistance (MDR1 and MRP) (34,35), and genes related to tumor invasion and metastasis (nm23 and CD44) (36,37). There are first reports on the use of multiplex real-time PCR, a development that is certainly going to facilitate diagnostic procedure in the next 5 yr (38,39).

From a research point of view, real-time PCR might facilitate the identification of new prognostic markers, because a large number of samples can be processed in a relatively short time (40,41). Another future application of TaqMan PCR is the confirmation of results obtained by cDNA microarrays, which will be abundantly used for cDNA screening. Of particular interest might be the chance to determine gene expression in very few cells using single-cell picking (42,43). Using this approach, not only can minimal involvement of tumor cells be visualized but also nonhomogenous distributions in malignant tumor might be monitored with respect to essential prognostic markers. It is of importance that in situ gene expression after laser capture microdissection might not only be performed in frozen sections but also from formalin-fixed and paraffin-embedded biopsies (44).
7 Conclusions TaqMan real-time PCR provides a reliable technology for the quantification of gene expression. However, a number of preconditions have to be met for each new marker. First, the system parameters reflecting amplification efficiency (slope) and linearity should match the minimal requirements. This should include the calculation of the intra-assay and interassay coefficient of variation with regard to the threshold cycle at which the amplification signal is detected. Second, the assay itself should be carefully evaluated with regard to a linear relationship between threshold cycle and the logarithm of a serial dilution of a reference sample. Third, real-time PCR results should be compared with a second, independent method for quantification, like quantitative competitive PCR. Finally, it should be assessed whether the results obtained with regard to clinical outcome represent the experiences obtained with other methods for gene detection.

Apart from a high degree of precision, practical advantages of real-time PCR are easy handling, rapid measurements, and a broad linear range for the measurements. Whereas competitive PCR only allows for the determination of few samples in one assay, TaqMan real-time PCR provides the opportunity to measure more than 80 samples at one time in a 96-well plate together with the control reactions needed.

SOURCE : http://www.springerlink.com/content/g6h3214l36011k1g/fulltext.html

read more
 

Popular Posts