Home | Looking for something? Sign In | New here? Sign Up | Log out

Tuesday, January 25, 2011

STEP BY STEP IMMUNOHISTOCHEMISTRY

Tuesday, January 25, 2011
0 comments

STEP BY STEP IMMUNOHISTOCHEMISTRY

Day 1.

1 ) Preparing the slides

- Deparafinize slides in Xylene x2 15-20 min ea.

Rehydrate

- 100% Ethanol, 2 min

- 100% Ethanol, 2 min

- 95% Ethanol, 2 min

- 95% Ethanol, 2 min

- 70% Ethanol, 2 min

- Milipore Water, 5 min

2) Antigen Unmasking

- 0.1% Trypsin (in 1x TBS) 5-20 min. at RT (200ml TBS 1X and .2 g Trypsin)

* (I usually do 15 min.)

3) Block Endogenous peroxidase activity

- Prepare 1% H2O2 in milipore water for 15 min. RT gentle shaking

4) Blocking/Primary Ab

- Pour off H2O2 and fill with TT buffer; wash in TT buffer 3x5min, RT, gentle shaking. Dry off buffer around sample (do NOT let sample dry or touch it with paper towel) and draw barrier around sample area with PAP pen. Keep slides in TT before and after drawing barrier

- Lay slides flat in humidified chamber (slide box w/wet paper towels) and add blocking buffer (in fridge). Shake gently for 20 min. RT

- Dilute primary Ab in blocking buffer

- Tip off blocking buffer and add 250-400ul of diluted antibody (or blocking buffer for neg control) incubate 15-20 min at RT then O/N at 4*C

Day 2

5) Secondary Ab

- Wash sections with TT buffer 4x5min. Do not cross contaminate the samples (ie neg control w/ Ab)

- Dilute secondary Ab 1:200 with TT buffer (NOT blocking buffer)

- Add 250-400ul diluted secondary Ab to each slide, incubate for 40 min. at RT, gentle shaking (prepare ABC while incubating)

6) ABC-HRP

- While secondary is incubating, prepare the ABC reagent- it must sit after mixing for at least 30-40 min, but try to make it no more than an hour ahead of time

* PBS 2.5ml

*Solution A 1 drop (biotin-avidin, 50ul), mix well, then

*Solution B 1 Drop (HRP, 50ul). Mix well

- Wash sections with TT buffer 3x 5min each.

- Add 250-400 ul of ABC-HRP to each slide. Incubate for 40 min (in humidified box) with genetle shaking

7.) DAB Reaction

- Wash sections 3x 5min with TT buffer

- Wash sections once with milipore water, and prepare fresh DAB substrate from Vector Kit. You can add nickel to the substrate, which makes the peroxidiase rxn gray/black instead of brown. However, we have found that the brown stain makes it easier to distinguish real staining from the background that often associates with blood cells within tumor sections:

o ddH2O 5.0 ml

o Buffer stock 2 drops

o DAB 4 drops

o H2O2 2 drops

o Nickel (optional) 2 drops

- lay slides flat on a paper towel or bench paper, and apply DAB substrate, 250-400 ul. Let rxn run 2-10 min. away from direct light. Monitor staining in microscope. Approximate development time must be determined empirically,

- Rinse with distilled water 2-3 times, 5min each

8) Counterstain/Dehydrate/ClearMount

- Counterstain with Hematoxylin for 1sec dip in staining dish. Filter Hematoxylin through whatman paper before using

- Rinse extensively with tap water

- Dehydrate (100% EtOH x 2) and clear with Xylene (1-2 min x2) Keep in Xylene until coverslip is mounted

- Mount with permount


read more

Sunday, January 16, 2011

SEQUENCING DNA IS EASY

Sunday, January 16, 2011
1 comments





DNA sequencing reactions are just like the PCR reactions for replicating DNA (refer to the previous page DNA Denaturation, Annealing and Replication). The reaction mix includes the template DNA, free nucleotides, an enzyme (usually a variant of Taq polymerase) and a 'primer' - a small piece of single-stranded DNA about 20-30 nt long that can hybridize to one strand of the template DNA.

The reaction is initiated by heating until the two strands of DNA separate, then the primer sticks to its intended location and DNA polymerase starts elongating the primer. If allowed to go to completion, a new strand of DNA would be the result. If we start with a billion identical pieces of template DNA, we'll get a billion new copies of one of its strands.



Dideoxynucleotides: We run the reactions, however, in the presence of a dideoxyribonucleotide. This is just like regular DNA, except it has no 3' hydroxyl group - once it's added to the end of a DNA strand, there's no way to continue elongating it.

Now the key to this is that MOST of the nucleotides are regular ones, and just a fraction of them are dideoxy nucleotides.

Replicating a DNA strand in the presence of dideoxy-T

MOST of the time when a 'T' is required to make the new strand, the enzyme will get a good one and there's no problem. MOST of the time after adding a T, the enzyme will go ahead and add more nucleotides. However, 5% of the time, the enzyme will get a dideoxy-T, and that strand can never again be elongated. It eventually breaks away from the enzyme, a dead end product.

Sooner or later ALL of the copies will get terminated by a T, but each time the enzyme makes a new strand, the place it gets stopped will be random. In millions of starts, there will be strands stopping at every possible T along the way.

ALL of the strands we make started at one exact position. ALL of them end with a T. There are billions of them ... many millions at each possible T position. To find out where all the T's are in our newly synthesized strand, all we have to do is find out the sizes of all the terminated products!




Here's how we find out those fragment sizes.

Gel electrophoresis can be used to separate the fragments by size and measure them. In the cartoon at left, we depict the results of a sequencing reaction run in the presence of dideoxy-Cytidine (ddC).

First, let's add one fact: the dideoxy nucleotides in my lab have been chemically modified to fluoresce under UV light. The dideoxy-C, for example, glows blue. Now put the reaction products onto an 'electrophoresis gel' (you may need to refer to 'Gel Electrophoresis' in the Molecular Biology Glossary), and you'll see something like depicted at left. Smallest fragments are at the bottom, largest at the top. The positions and spacing shows the relative sizes. At the bottom is the smallest fragment that's been terminated by ddC; that's probably the C closest to the end of the primer (which is omitted from the sequence shown). Simply by scanning up the gel, we can see that we skip two, and then there's two more C's in a row. Skip another, and there's yet another C. And so on, all the way up. We can see where all the C's are.


Putting all four deoxynucleotides into the picture:

Well, OK, it's not so easy reading just C's, as you perhaps saw in the last figure. The spacing between the bands isn't all that easy to figure out. Imagine, though, that we ran the reaction with *all four* of the dideoxy nucleotides (A, G, C and T) present, and with *different* fluorescent colors on each. NOW look at the gel we'd get (at left). The sequence of the DNA is rather obvious if you know the color codes ... just read the colors from bottom to top: TGCGTCCA-(etc).

(Forgive me for using black - it shows up better than yellow).



An Automated sequencing gel:

That's exactly what we do to sequence DNA, then - we run DNA replication reactions in a test tube, but in the presence of trace amounts of all four of the dideoxy terminator nucleotides. Electrophoresis is used to separate the resulting fragments by size and we can 'read' the sequence from it, as the colors march past in order.

In a large-scale sequencing lab, we use a machine to run the electrophoresis step and to monitor the different colors as they come out. Since about 2001, these machines - not surprisingly called automated DNA sequencers - have used 'capillary electrophoresis', where the fragments are piped through a tiny glass-fiber capillary during the electrophoresis step, and they come out the far end in size-order. There's an ultraviolet laser built into the machine that shoots through the liquid emerging from the end of the capillaries, checking for pulses of fluorescent colors to emerge. There might be as many as 96 samples moving through as many capillaries ('lanes') in the most common type of sequencer.

At left is a screen shot of a real fragment of sequencing gel (this one from an older model of sequencer, but the concepts are identical). The four colors red, green, blue and yellow each represent one of the four nucleotides.

The actual gel image, if you could get a monitor large enough to see it all at this magnification, would be perhaps 3 or 4 meters long and 30 or 40 cm wide.



A 'Scan' of one gel lane:

We don't even have to 'read' the sequence from the gel - the computer does that for us! Below is an example of what the sequencer's computer shows us for one sample. This is a plot of the colors detected in one 'lane' of a gel (one sample), scanned from smallest fragments to largest. The computer even interprets the colors by printing the nucleotide sequence across the top of the plot. This is just a fragment of the entire file, which would span around 900 or so nucleotides of accurate sequence.

The sequencer also gives the operator a text file containing just the nucleotide sequence, without the color traces.


As you have seen, we can get the sequence of a fragment of DNA as long as 900 or so nucleotides. Great! But what about longer pieces? The human genome is 3 *billion* bases long, arranged on 23 pairs of chromosomes. Our sequencing machine reads just a drop in the bucket compared to what we really need!

To do it, we break the entire genome up into manageable pieces and sequence them. There are two approaches currently in use:

* The Publically-funded Human Genome Project: The National Institutes of Health and the National Science Foundation have funded the creation of 'libraries' of BAC clones. Each BAC carries a large piece of human genomic DNA on the order of 100-300 kb. All of these BACs overlap randomly, so that any one gene is probably on several different overlapping BACs. We can replicate those BACs as many times as necessary, so there's a virtually endless supply of the large human DNA fragment.

In the Publically-funded project, the BACs are subjected to shotgun sequencing (see below) to figure out their sequence. By sequencing all the BAC's, we know enough of the sequence in overlapping segments to reconstruct how the original chromosome sequence looks.

* A Privately-Funded Sequencing Project: Celera Genomics An innovative approach to sequencing the human genome has been pioneered by Celera Genomics. The founders of this company realized that it might be possible to skip the entire step of making libraries of BAC clones. Instead, they blast apart the entire human genome into fragments of 2-10 kb and sequence those. Now the challenge is to assemble those fragments of sequence into the whole genome sequence.

Imagine, for example that you have hundreds of 500-piece puzzles, each being assembled by a team of puzzle experts using puzzle-solving computers. Those puzzles are like BACs - smaller puzzles that make a big genome manageable. Now imagine that Celera throws all those puzzles together into one room and scrambles the pieces. They, however, have scanners that scan all the puzzle pieces and huge computers that figure out where they all go.

It is controversial still as to whether the Celera approach will succeed on a puzzle as large as the human genome. Whether it does or not, they have certainly stirred up the intellectual pot a bit.



Shotgun sequencing: assembly of random sequence fragments
To sequence a BAC, we take millions of copies of it and chop them all up randomly. We then insert those into plasmids and for each one we get, we grow lots of it in bacteria and sequence the insert. If we do this to enough fragments, eventually we'll be able to reconstruct the sequence of the original BAC based on the overlapping fragments we've sequenced!

read more

Saturday, January 15, 2011

THE CHROMOSOMAL BASIS OF MAMMALIAN SEX DETERMINATION

Saturday, January 15, 2011
0 comments

In 1916, Bridges described the sex chromosomes of the fruit fly Drosophila melanogaster, ascribing the sex
determining mechanism to the X:autosome ratio, i.e.,2:2 in females (XX), 1:2 in males (XY). When the human
X and Y chromosomes were first described by Painter (177), it was initially thought that humans would have a
similar mechanism. Another 30 years elapsed before the first sex chromosome aneuploid mammals were
discovered, which overturned this hypothesis and conclusively demonstrated that mammalian sex determination
is dependent on the Y chromosome. In humans, XXY individuals develop testes (103) and XO individuals
develop ovaries (75). Consequently, if sex were determined by the X:autosome ratio, the reverse would
have been true. In the following three decades it became increasingly obvious that development of testes is associated with the presence of a single Y-linked gene locus, dubbed TDF (testis determining factor) in humans and Tdy in mice. For simplicity, we will refer to both as TDY. As in all genetic analysis, this understanding arose out of the examination of mutations both in human and mouse that led to varying degrees of sex reversal, i.e., the chromosomal sex does not correlate with the observed sex. However, sterility is also usually a consequence of sex-reversing mutations, and therefore, such cases are generally sporadic, making conventional pedigree-based positional mapping difficult or impossible. Identification of TDY therefore had to rely on the study of sporadic cases of sex reversal

read more

Tuesday, January 11, 2011

Quantitative TaqMan Real-Time PCR Diagnostic and Scientific Applications

Tuesday, January 11, 2011
0 comments

Jörg Dötsch1, Ellen Schoof1 and Wolfgang Rascher1
(1) Department of Pediatrics, University of Erlangen, Erlangen, Germany

1 Principles of TaqMan Real-Time PCR
The use of the TaqMan reaction has been described in a number of original and review articles (3–5). This approach makes use of the 5′ exonuclease activity of the DNA polymerase (AmpliTaq Gold). Briefly, within the amplicon defined by a gene-specific PCR primer pair, an oligonucleotide probe labeled with two fluorescent dyes is created, designated as the TaqMan probe. As long as the probe is intact, the emission of the reporter dye (i.e., 6-carboxy-fluorescein, FAM) at the 5′ end is quenched by the second fluorescence dye (6-carboxy-tetramethyl-rhodamine, TAMRA) at the 3′ end. During the extension phase of PCR, the polymerase cleaves the TaqMan probe, resulting in a release of reporter dye. The increasing amount of reporter dye emission is detected by an automated sequence detector combined with a dedicated software (ABI Prism 7700 Sequence Detection System, Perkin-Elmer, Foster City, CA). The algorithm normalizes the reporter signal (Rn) to a passive reference. Next, the algorithm multiplies the standard deviation of the background Rn in the first few cycles (in most PCR systems, cycles 3-15, respectively) by a default factor of 10 to determine a threshold. The cycle at which this baseline level is exceeded is defined as the threshold cycle (Ct) (see Fig. 1 ). Ct has a linear relation with the logarithm of the initial template copy number. Its absolute value additionally depends on the efficiency of both DNA amplification and cleavage of the TaqMan probe. The Ct values of the samples are interpolated to an external reference curve constructed by plotting the relative or absolute amounts of a serial dilution of a known template vs the corresponding Ct values. The oligonucleotides of each target of interest can be designed by the Primer Express software (Perkin-Elmer) using uniform selection parameters.
MediaObjects/978-1-59259-870-0_23_Fig1_HTML.jpg
Fig. 1. Sketch of the principle of TaqMan PCR for the quantification of gene expression. By measuring the amplicon concentration in the early exponential phase of the PCR reaction, the exhaustion of reagents is avoided. (Modified from ref. 3.)
2 Reliability and Validation of TaqMan Real-Time PCR

The use of TaqMan real-time PCR for the quantification of gene expression has been shown to be at least as reliable as the application other quantitative PCR techniques, like competitive PCR (6,7). Whereas the expression of highly expressed genes like the housekeeping gene glyceraldehyde-3-phosphate is well correlated between the two methods, for the determination of genes with lower expression like the neuropeptide Y TaqMan PCR is much more sensitive than competitive PCR (6) (see Fig. 2 ). In addition, the spectrum of linear measurements for realtime PCR is in the range of 106, in contrast to 102 in competitive RT-PCR. Finally, a considerably higher number of samples per day can be measured by real-time PCR (up to 400 measurements). In comparison to the Northern blot assessment, only a minimal fraction of mRNA is necessary to quantify gene expression by real-time PCR (8,9). RNA can be extracted using standard techniques like commercial RNA isolation kits (e.g., RNAzol-B isolation kit; WAK-Chemie Medical GmbH, Bad Homburg, Germany) or conventional phenol-chloroform extraction for DNA (10).
3 Applications for TaqMan Real-Time PCR

A number of applications for TaqMan real-time PCR have been introduced in the last few years, the most important being the quantification of gene expression. Some of the most important applications and potential applications will be discussed below.
3.1 Quantification of Gene Expression
Quantification of gene expression has been facilitated to a considerable degree by the use of real-time techniques such as TaqMan PCR. This technique has practically replaced less sensitive and more time-consuming methods such as Northern blot or RNAse protection assay. Quantitative competitive PCR (7) is less effective and less sensitive as well (6). Crucial aspects in the measurements of gene expression by real-time PCR are the preparation of RNA especially in samples that only contain small amounts of the specific mRNA, such as single-cell picking or microdissection (see Subheading 7 .). On the other hand, quantification can be difficult; in general, housekeeping genes can be applied (e.g., by using duplex approaches). Alternatively, external standards can be considered (11).
MediaObjects/978-1-59259-870-0_23_Fig2_HTML.jpg
Fig. 2. Relation of gene expression as assessed by competitive quantitative and TaqMan real-time PCR. (A) mRNA expression of GAPDH. r = 0.92, p< 0.001. (B) mRNA expression of NPY. r = 0.87, p< 0.001 (Adapted from ref. 6.)
In most cases of mRNA quantification, gene expression has to be related to housekeeping genes that are expressed relatively stable throughout the cells. In the studies performed on gene expression in neuroblastomas so far, three different housekeeping genes have been assessed: the more traditional genes glyceraldehyde-3-phosphate (GAPDH) (6) and β-actin (10) and the neuronal marker protein gene product 9.5 (PGP9.5) (6). One major general difficulty in the use of housekeeping genes for the determination of mRNA transcript ratios is the possibility that their expression might also be altered by coexpression of pseudogenes and environmental changes (e.g., by hypoxia in case of GAPDH) (12). Pseudogenes can be eliminated using primer combinations that are intron spanning. However, unidentified influences cannot be dealt with as easily. Therefore, we used at least two housekeeping genes for quantification of mRNA expression. However, this aspect clearly needs further evaluation. In our group, a number of primers and TaqMan probes have been used for housekeeping gene amplification (6,13) ( Table 1 ).

Table 1

Primers and TaqMan Probes Used for the Quantification of Human Housekeeeping Gene Expression

\gb-Actin


Probe


CCAGCCATGTACGTTGCTATCCAGGC


Forward


GCGAGAAGATGACCCAGGATC


Reverse


CCAGTGGTACGGCCAGAGG

GAPDH


Probe


CCTCAACTACATGGTTTACATGTTCCAATATGATTCCAC


Forward


GCCATCAATGACCCCTTCATT


Reverse


TTGACGGTGCCATGGAATTT

PBGD


Probe


CTTCGCTGCATCGCTGAAAGGGC


Forward


TGTGCTGCACGATCCCG


Reverse


ACACTGCAGCCTCCTTCCAG

HPRT


Probe


CGCAGCCCTGGCGTCGTGATTA


Forward


CCGGCTCCGTTATGGC


Reverse


GGTCATAACCTGGTTCATCATCA

\gb2MG


Probe


TGATGCTGCTTACATGTCTCGATCCCA


Forward


TGACTTTGTCACAGCCCAAGATA


Reverse


CCAAATGCGGCATCTTC

Abbreviations: GAPDH: glyceraldehyd-3-phosphate dehydrogenase, PBGD: porphobilinogen deaminase, HPRT: hypoxanthine-guanine-phosphoribosyl-transferase, \gb2MG: \gb2-microglobulin.

Source: Data from refs. 6and 13-15.
3.2 Quantification of Gene Copy Number, Determination of Minimal Residual Disease, and Allelic Discrimination in Malignant Tumors
3.2.1 MYCN Detection by TaqMan PCR in Neuroblastoma Tissue

DNA copy number, MYCN amplification in neuroblastomas, is of great potential interest with regard to the prognosis of disease. In fact, in clinical practice, MYCN gene expression correlates with both advanced disease stage (16) and rapid tumor progression (17).

Several methods have been used for the detection of MYCN detection mainly based on Southern or dot blot (18,19), on quantitative PCR (20), and on fluorescent in situ hybridization techniques (21). The use of most PCR methods is restricted, however, by the fact that end-point measurements are used for quantification. Therefore, Raggi and co-workers (10) introduced a TaqMan real-time base method for the determination of MYCN amplification in neuroblastomas. The authors demonstrate a precise assay with an interassay coefficient of variation of 13‰ and an intraassay coefficient of variation of 11‰. The threshold cycle for the detection of MYCN correlates in an inverse linear way with the logarithm of the input of genomic DNA molecules. There is a good linear relationship between the MYCN amplification measured by TaqMan real-time PCR and competitive PCR. Using Kaplan-Meier survival curves, the authors showed that the amplification of MYCN as assessed by TaqMan real-time PCR is closely linked to cumulative survival, as this had already been demonstrated with several other techniques for the quantification of MYCN amplification.
3.2.2 Minimal Residual Disease

Another important aspect of real-time PCR in the field of oncology is the detection of minimal residual disease that is 100- to 1000-fold more sensitive than traditional methods. As few as five copies can be detected in one reaction (11), but the maximal input of DNA during sample preparation is the limiting step. This limitation must, therefore, be considered when looking for minimal residual disease in malignant diseases such as childhood or adulthood acute lymphoblastic leukemia (22,23).

Various methods have been used to study tumor cytogenetic aberrations in malignant tumors for clinical decision-making. Initially, conventional cytogenetic techniques were applied. Karyotyping by conventional cytogenetics, however, depends on dividing cells, and successful evaluations are often hampered by inferior metaphase quality. Following this, restriction fragment length polymorphisms (RFLPs), PCR-based microsatellite, and fluorescence in situ hybridization (FISH) analyses have been applied to overcome the restrictions of conventional cytogenetics. However, RFLP- and PCR-based microsatellite analyses depend on informative loci in the region of interest and the need for normal reference DNA of the respective patient, whereas FISH analyses are sometimes hampered by inferior tissue quality and hybridization probe availability. The latest technique used for routine detection of cytogenetic aberrations is comparative genomic hybridization CGH (24). CGH has proved to be consecutively applicable to tumor specimens for the detection of most aberrations known from conventional cytogenetics, but deletions of smaller DNA regions might be undetectable. Thus, this technique should be used to prescreen tumor samples for gross cytogenetic aberrations and be supplemented by a TaqMan PCR-based approach to detect loss or gain of DNA on the single-gene level.
3.3 Pathogene Detection and Quantification

Real-time PCR can be of great benefit in the detection and quantification of pathogens such as viruses, bacteria, and fungi. The method proves to be useful in the use for environmental detection (25) and in infected patients.

Several difficulties, however, can occur (11). In contrast to traditional methods of microbiology, vital and dead microorganisms are both detected. Second, most infectious organisms are characterized by a high mutation rate, which might influence the estimation of viral or bacterial load dramatically (26). Finally, quantification necessitates the use of reliable standards. This can be achieved by using duplex or multiplex assays (27). To assure permanent quality and the possibility of comparing results, international standardization will have to be obtained in the future.
4 Limitations and Pitfalls in the Use of TaqMan Real-Time PCR

The use of TaqMan PCR can be particularly difficult if gene expression at a low level is to be quantified. One major pitfall in this context is the accidental determination of genomic DNA when RT-PCR is intended. There are various approaches to meet this problem: It is always useful to select primer combinations that are intron spanning (2). If there is no possibility to select intron-spanning primers, RNA samples can be pretreated with DNAse. However, this measure should not be chosen routinely and can also be deleterious if only small amounts of RNA are present that are partially destroyed as well (28).

One other difficulty is the high degree of technical expertise that is required to achieve as low a variation coefficient and as sensitive a measurement as possible. It could be shown that the degree of technical expertise can alter the gene level that is measured by up to 1000-fold (28). Because real-time PCR is highly sensitive, the risk of having interference with minor contamination is quite considerable. On the other hand, the risk of false-negative results must not be underestimated because post-hoc PCR steps are not “visible” to the degree that is provided by the more traditional methods for gene quantification (11).
5 Alternative Real-Time PCR Methods

There are other methods for real-time PCR not relying on exonuclease cleavage of a specific probe to generate a fluorescence signal. One of them, the LightCycler System (Roche Molecular), makes use of so-called “hybridization probes” (29,30). Like exonuclease probes, hybridization probes are used in addition to the PCR primers. However, unlike the first, hybridization probes combine two different fluorescent labels to allow resonance energy transfer. One of them is activated by external light. When both probes bind very closely at the DNA molecules generated by the PCR-amplification process, the emitted light from the first dye activates the fluorescent dye of the second probe. This second dye emits light with a longer wavelength, which is measured every cycle. Thus, the fluorescence intensity is directly correlated to the extent of probe hybridization and, subsequently, directly related to the amount of PCR product. A major advantage of the LightCycler is the very short time of the PCR run. However, the TaqMan system allows one to analyze a higher number of samples at one time and, at least theoretically, might be more accurate, as there is an internal reference dye to monitor minor variations in sample preparation.

Apart from exonuclease and hybridization methods for real-time PCR, there are other options, including hairpin probes, hairpin primers, and intercalating fluorescent dyes. Hairpin probes, also known as molecular beacons, contain reverse complement sequences at both ends binding together while the rest of the strand remains single stranded, creating a panhandlelike structure. In addition, there are fluorescent dyes at both ends of the molecule: a reporter and a quencher similar to the TaqMan probes. In the panhandlelike conformation, there is no fluorescence, as the fluorescent reporter at one end and the quencher at the other end of the probe are very close to one another (31). As the central part of a molecular beacon consists of a target-specific sequence, both ends are separated from each other when this part of the molecule is bound to the PCR product and a fluorescence signal can be emitted from the reporter dye. Hairpin primers, also named “amplifluor primers,” are similar to molecular beacons, but fluorescence is generated as they become incorporated into the double-stranded PCR product during amplification. Another very simple technique for monitoring the generation of PCR product in a real-time fashion is the use of intercalating dyes, such as EtBr and SYBR green I, which do not bind to single-stranded DNA but to the double-stranded PCR product (30,32). However, hairpin primers and intercalating dyes do not offer the high specificity of the probe-based techniques and a positive signal might even be generated by primer dimers.
6 Future Developments

From a diagnostic point of view, one interesting aspect for the future might be the use of semiautomated or automated real-time devices for the assessment of gene expression and amplification, putting into consideration the relatively easy and low time-consuming method of measurement. For diseases such as neuroblastoma, real-time PCR might help to quantify more prognostic markers like the nerve growth factor receptor (TRKA gene) (33), the expression of genes involved in multidrug resistance (MDR1 and MRP) (34,35), and genes related to tumor invasion and metastasis (nm23 and CD44) (36,37). There are first reports on the use of multiplex real-time PCR, a development that is certainly going to facilitate diagnostic procedure in the next 5 yr (38,39).

From a research point of view, real-time PCR might facilitate the identification of new prognostic markers, because a large number of samples can be processed in a relatively short time (40,41). Another future application of TaqMan PCR is the confirmation of results obtained by cDNA microarrays, which will be abundantly used for cDNA screening. Of particular interest might be the chance to determine gene expression in very few cells using single-cell picking (42,43). Using this approach, not only can minimal involvement of tumor cells be visualized but also nonhomogenous distributions in malignant tumor might be monitored with respect to essential prognostic markers. It is of importance that in situ gene expression after laser capture microdissection might not only be performed in frozen sections but also from formalin-fixed and paraffin-embedded biopsies (44).
7 Conclusions TaqMan real-time PCR provides a reliable technology for the quantification of gene expression. However, a number of preconditions have to be met for each new marker. First, the system parameters reflecting amplification efficiency (slope) and linearity should match the minimal requirements. This should include the calculation of the intra-assay and interassay coefficient of variation with regard to the threshold cycle at which the amplification signal is detected. Second, the assay itself should be carefully evaluated with regard to a linear relationship between threshold cycle and the logarithm of a serial dilution of a reference sample. Third, real-time PCR results should be compared with a second, independent method for quantification, like quantitative competitive PCR. Finally, it should be assessed whether the results obtained with regard to clinical outcome represent the experiences obtained with other methods for gene detection.

Apart from a high degree of precision, practical advantages of real-time PCR are easy handling, rapid measurements, and a broad linear range for the measurements. Whereas competitive PCR only allows for the determination of few samples in one assay, TaqMan real-time PCR provides the opportunity to measure more than 80 samples at one time in a 96-well plate together with the control reactions needed.

SOURCE : http://www.springerlink.com/content/g6h3214l36011k1g/fulltext.html

read more

Monday, January 10, 2011

Analyzing the Genome One Cell at a Time

Monday, January 10, 2011
0 comments

Gene Expression and DNA Sequence Analysis at the Single-Cell Level Reveal Heterogeneity.

Early studies of gene expression in single cells revealed a greater than expected amount of heterogeneity among cells from supposedly homogeneous populations. It is now well accepted that, for example, not every tumor cell, liver cell, or stem cell isolated from a distinct population will be identical in terms of which genes are expressed and at what levels.

Simply averaging the transcription levels measured across multiple individual cells will not accurately convey what is taking place in any one cell. Furthermore, this approach may result in an especially interesting and biologically or clinically relevant characteristic of one or more of the cell subtypes present in a cell population to be missed if their genomic heterogeneity is not analyzed and understood.

The desire to characterize this variability in gene expression across cells and to acquire genomic sequence data on a single-cell level is driving advances in the field of single-cell genomics, which is part of a broader field of single-cell analysis that is benefiting from an emerging trend to develop and apply tools and technologies for robust, high-throughput, and reproducible analysis of biological function at the single-cell level.

Initial focus areas include developmental biology and cancer and stem cell research; early commercial applications relate to embryo screening for in vitro fertilization (IVF) procedures, characterization and drug-response testing of circulating tumor cells, and infectious-disease diagnostics. Single-cell genomic analysis was a key area of discussion at Select Biosciences’ “Single Cell Analysis Summit” held recently in San Diego.

In reality, “most cells have very few transcripts, and a few cells have a lot of gene expression,” explained Mikael Kubista, Ph.D., CEO of Tataa Biocenter. Gene expression is a highly dynamic process, occurring in bursts of active transcription followed by less active periods during which existing mRNA transcripts decay.

“We have found that these bursts generally do not correlate from cell to cell,” Dr. Kubista said. This led the company to develop its single-cell transcription correlation platform, in which identification of a cell type is not based on the level of any particular transcript, but rather on correlations of transcription.

Using single-cell expression correlation, it is possible to distinguish between two or more subtypes of cells within a population that express the same transcripts. They differ not in the presence or absence of a particular transcript, but in the pattern of gene-expression levels. One way Tataa is applying this technology is to study circulating tumor cells, with a clinical goal of identifying what clones are present in a patient’s blood and to which chemotherapeutic agents they may/may not respond.

Tataa developed a technique for measuring intracellular mRNA gradients using qPCR and applies it to the study of gene-expression heterogeneity at the single-cell and subcellular level. To capture mRNA transcripts from a single cell without significant loss of material, Tataa formulated a set of detergents to facilitate cell lysis and mRNA removal without the need for washing steps. It licensed the detergents to Roche, which incorporated them into its RealTime Ready Cell Lysis Kit.

Dr. Kubista identified three main challenges at present for single-cell gene-expression analysis including the need for robust single-cell isolation techniques, increased throughput, and improved tools for data mining and multivariate data analysis.

Steven Bodovitz, Ph.D., principal at Bioperspectives, defined the opportunity in this field as the ability to “transform cellular heterogeneity from a source of noise into a source of new discoveries.”

The reasons to do so are “compelling,” he said. For example, if an easy and more reliable method was available to identify the different cell subtypes in a tumor, could a more effective, multitargeted chemotherapeutic approach be developed?

Dr. Bodovitz identified two main drivers of single-cell omics research: the potential biological significance of understanding cell heterogeneity, and the enabling technological advances including miniaturization, microfluidics, and whole-genome amplification (WGA) techniques that yield enough DNA from a single cell to enable genomic analysis using available gene-expression analysis or next-generation sequencing (NGS) methods.

When asked to identify the main challenge the field of single-cell genomics currently faces, Dr. Bodovitz pointed to the need for improved methods of isolating single cells from tissue samples. “One tends to destroy the cell to analyze it.”

Whereas perturbations to a cell are unlikely to affect the results of genetic or epigenetic analysis, as these characteristics should remain stable, cellular disruption could affect gene-expression analysis and other types of omics studies. Intentional perturbation of a single cell represents an “elegant system” for studying biological pathways and intracellular networks based on the up- or downregulation of gene expression, added Dr. Bodovitz. This knowledge could be used to guide the design of drugs capable of interfering in a particular pathway.

http://genengnews.com/gen-articles/analyzing-the-genome-one-cell-at-a-time/3497/

read more

INTRODUCTION TO REAL TIME PCR

0 comments

Introduction to Real Time PCR


As the name suggests, real time PCR is a technique used to monitor the progress of a PCR reaction in real time. At the same time, a relatively small amount of PCR product (DNA, cDNA or RNA) can be quantified. Real Time PCR is based on the detection of the fluorescence produced by a reporter molecule which increases, as the reaction proceeds. This occurs due to the accumulation of the PCR product with each cycle of amplification. These fluorescent reporter molecules include dyes that bind to the double-stranded DNA (i.e. SYBR® Green ) or sequence specific probes (i.e. Molecular Beacons or TaqMan® Probes). Real time PCR facilitates the monitoring of the reaction as it progresses. One can start with minimal amounts of nucleic acid and quantify the end product accurately. Moreover, there is no need for the post PCR processing which saves the resources and the time. These advantages of the fluorescence based real time PCR technique have completely revolutionized the approach to PCR-based quantification of DNA and RNA. Real time PCR assays are now easy to perform, have high sensitivity, more specificity, and provide scope for automation. Real time PCR is also referred to as real time RT PCR which has the additional cycle of reverse transcription that leads to formation of a DNA molecule from a RNA molecule. This is done because RNA is less stable as compared to DNA

Real Time PCR procedure


In a real time PCR protocol, a fluorescent reporter molecule is used to monitor the PCR as it progresses. The fluorescence emitted by the reporter molecule manifolds as the PCR product accumulates with each cycle of amplification. Based on the molecule used for the detection, the real time PCR techniques can be categorically placed under two heads:

1. Non-specific detection using DNA binding dyes

2. Specific detection target specific probes

Non-specific detection using DNA binding dyes:
In real time PCR, DNA binding dyes are used as fluorescent reporters to monitor the real time PCR reaction. The fluorescence of the reporter dye increases as the product accumulates with each successive cycle of amplification. By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase. If a graph is drawn between the log of the starting amount of template and the corresponding increase the fluorescence of the reporter dye fluorescence during real time PCR, a linear relationship is observed.

SYBR® Green is the most widely used double-strand DNA-specific dye reported for real time PCR. SYBR® Green binds to the minor groove of the DNA double helix. In the solution , the unbound dye exhibits very little fluorescence. This fluorescence is substantially enhanced when the dye is bound to double stranded DNA. SYBR® Green remains stable under PCR conditions and the optical filter of the thermocycler can be affixed to harmonize the excitation and emission wavelengths. Ethidium bromide can also be used for detection but its carcinogenic nature renders its use restrictive.

Although these double-stranded DNA-binding dyes provide the simplest and cheapest option for real time PCR, the principal drawback to intercalation based detection of PCR product accumulation is that both specific and nonspecific products generate signal.

Specific detection using target specific probes:
Specific detection of real time PCR is done with some oligonucleotide probes labeled with both a reporter fluorescent dye and a quencher dye. Probes based on different chemistries are available for real time detection, these include:

a. Molecular Beacons
b. TaqMan® Probes
c. FRET Hybridization Probes
d. Scorpion® Primers

Real time PCR applications include

1 . Quantitative mRNA expression studies.
2 . DNA copy number measurements in genomic or viral DNAs.
3 . Allelic discrimination assays or SNP genotyping.
4 . Verification of microarray results.
5 . Drug therapy efficacy.
6 . DNA damage measurement.

Real Time PCR VS Traditional PCR

Real time PCR allows for the detection of PCR product during the early phases of the reaction. This ability of measuring the reaction kinetics in the early phases of PCR provide a distinct advantage over traditional PCR detection. Traditional methods use gel electrophoresis for the detection of PCR amplification in the final phase or at end-point of the PCR reaction.

read more

DuPont Acquires Danisco in $6.3B Deal

1 comments

Genetic Engineering & Biotechnology News
Quick Links
  Visit GEN on Twitter
 
GEN NEWS HIGHLIGHTS
Monday, January 10, 2011


DuPont Acquires Danisco in $6.3B Deal
Acquisition further strengthens DuPont's position in the industrial biotechnology field.

GSK Pays Epizyme $20M Up Front as Part of Histone Methyltransferase Inhibitor Deal
Development of HMT therapeutics against targets for cancer and other diseases is primary objective.

FDA Approves ProStrakan's Abstral for Breakthrough Cancer Pain
Company claims transmucosal product already has 24% share of fast-acting fentanyl market in major EU markets.

Civitas Raises $20M for Parkinson Disease Program
Company is developing a dry powder pulmonary delivery platform.

Biocartis Signs Assay Deal for Its MDx Platform with Janssen Pharmaceutica
J&J subsidiary will develop neurological disease and infectious viral disease assays.

AMT Secures Option to License Sanfilippo B Gene Therapy from Institut Pasteur-Led Consortium
AMT may acquire full commercial rights to product at end of Phase I/II trial.

Celtic Therapeutics Acquires and Licenses Rights to Resolvyx' RX-10045
Agreement will allow further development of Resolvin-based therapy.

Ardea Biosciences Gets $15M from Bayer Upon Start of Phase II Trial with Liver Cancer Compound
Ardea has received $50 million so far from its deal with Bayer, with potential to earn another $357 million.

BMS and Pharmasset to Combine HCV Candidates in Proof-of-Concept Study
Trial will fuse BMS NS5A replication inhibitor with Pharmasset's NS5B polymerase blocker.

LabCorp to Market On-Q-ity's CTC Platform for Cancer Drug Discovery and Development
Firms claim microfluidics-based system will provide early indicator of drug response.


You can view more news broken down into over 90 categories and updated daily.


Analysis & Insight
Analysis & Insight What Will Succeed Lipitor as the Next Blockbuster Cholesterol-Lowering Drug?
CEPT inhibitors are vying to take over from statins, but one major failure hovers ominously.     More A&Is

Webinars
Available on Demand: Original Broadcast Date - December 16, 2010
Simplifying Targeted Protein Quantification with Mass Spec: The SRM Atlas and Multiplexed MRM Protein Assays
Sponsored by: Agilent Technologies

In Case You Missed It:
If you couldn't attend a previous webinar, be sure to check out our On-Demand Archives.


Application Note Library
More App Notes

Online Exclusives

BLOGBIOTECH:
Will FDA Bid Adieu to Auld Lang Syne and Open Up to New Drugs and Devices    More Blogs
POLL:
Do you think the Green Movement goes too far in its opposition of many new technologies?    More Polls



More at GEN
GEN Subscriber Tools



Subscription Center l Unsubscribe l Update Your Profile l About GEN

IMPORTANT! Make sure you receive your chosen GEN e-Newsletters. Add update@genengnews.com to your Address Book or Safe Senders List. It's easy! Click HERE for instructions.

Contact Us For:
Advertising   Editorial   Business and Partnership Opportunities


This email was sent by:
Genetic Engineering & Biotechnology News
140 Huguenot St.,
New Rochelle, NY 10801, USA
 

read more
 

Popular Posts